Multi Sample Reactive Protein Analysis

rbprotein

Multi-sample proteinprotein interplay evaluation and visualization instrument

 

We posit the possible structure of advanced ailments is that subgroups of sufferers share variants in genes in particular networks that are enough to offer rise to a shared phenotype. We developed Proteinarium, a multi-sample protein-protein interplay (PPI) instrument, to establish clusters of sufferers with shared gene networks.

 

 

Proteinarium converts person outlined seed genes to protein symbols and maps them onto the STRING interactome. A PPI community is constructed for every pattern utilizing Dijkstra’s algorithm. Pairwise similarity scores are calculated to check the networks and cluster the samples.

 

 

A layered graph of PPI networks for the samples in any cluster might be visualized. To check this newly developed evaluation pipeline, we reanalyzed publicly out there information units, from which modest outcomes had beforehand been achieved.

We discovered important clusters of sufferers with distinctive genes which enhanced the findings within the unique research.

 

rbprotein
rbprotein

Linking TPPII to the protein interplay and signalling networks

  • Tripeptidyl peptidase II (TPPII) is primarily thought-about a house-keeping exopeptidase, which contributes to the features of the ubiquitin-proteasome system by the upkeep of the mobile amino acid homeostasis.
  • Though functionally well-characterised in vitro and utilizing the mammalian cell fashions, much less is thought in regards to the molecular mechanisms of its involvement within the signaling and metabolic pathways, which mediate its mobile features.
  • The current protein-protein interplay community evaluation recognized these mechanisms concerned within the adaptive and innate immunity, the metabolism of the glucose, most cancers cell development, apoptosis, cell cycle and DNA injury responses.
  • The interplay community constructed primarily based on the publicly out there protein-protein interplay information was prolonged by the utility GeneMania, which was additional used for the pathway enrichment, the protein operate prediction and the protein node prioritisation evaluation.

    Anti-Alpha Fetoprotein antibody

  • The evaluation prompt that the molecular mechanisms linked to the adaptive and innate immunity (ID, Package receptor, BCR, IL-2 and G-CSF signalling; the regulation of NFκB), the cardio glycolysis (ID and IL-2 signalling), tumorigenesis (TGF-β and p53 signalling; the highest precedence nodes MAPKs, mTOR regulation), diabetes (Package receptor signalling; the highest precedence node GSK3β) and neurodegeneration (the management of mTOR and Aβ peptide degradation) are controlling the ensuing TPPII interplay community.
  • The uncharacterized interactions with two lung most cancers suppressors (DOK3, DENND2D), a protein concerned within the elevated danger of the lung most cancers in people who smoke (CYP1A1) and a protein implicated in asthmatic reactions (CHIA) recommend potential roles of TPPII within the lung most cancers pathology.
  • The interactions with methyltransferase CARNMT1, which modifies di- and tripeptides and the xenobiotic processing enzyme CYP1A1, are further candidates for the breakthrough in new features discovery of TPPII.

Anti-alpha-Fetoprotein Purified

11-259-C025 0.025 mg
EUR 90

Anti-alpha-Fetoprotein Purified

11-259-C100 0.1 mg
EUR 140

Anti-alpha-Fetoprotein Purified

11-384-C025 0.025 mg
EUR 90

Anti-alpha-Fetoprotein Purified

11-384-C100 0.1 mg
EUR 140

anti-alpha 1 Fetoprotein

YF-PA10111 50 ul
EUR 363
Description: Mouse polyclonal to alpha 1 Fetoprotein

anti-alpha 1 Fetoprotein

YF-PA10112 100 ul
EUR 403
Description: Rabbit polyclonal to alpha 1 Fetoprotein

anti-alpha 1 Fetoprotein

YF-PA10113 100 ug
EUR 403
Description: Rabbit polyclonal to alpha 1 Fetoprotein

Anti-Alpha-Fetoprotein antibody

STJ16100498 100 µg
EUR 354

Anti-Alpha Fetoprotein antibody

STJ16100499 100 µg
EUR 354

Anti-Alpha Fetoprotein antibody

STJ16100500 100 µg
EUR 354

Anti-Alpha Fetoprotein antibody

STJ16100501 100 µg
EUR 354

Anti-Alpha-Fetoprotein antibody

STJ16100608 100 µg
EUR 406

Anti-Alpha-Fetoprotein antibody

STJ16100609 100 µg
EUR 406

Anti-Alpha Fetoprotein antibody

STJ16100833 1 mL
EUR 790

Anti-Alpha fetoprotein antibody

STJ16101059 100 µg
EUR 354

Anti-Alpha fetoprotein antibody

STJ16101060 100 µg
EUR 354

Anti-Alpha fetoprotein antibody

STJ16101061 100 µg
EUR 354

Anti-Alpha-Fetoprotein antibody

STJ16101352 1 mL
EUR 343

Anti-alpha-fetoprotein antibody

STJ16101354 100 µg
EUR 381

Anti-alpha fetoprotein antibody

STJ16101445 1 mL
EUR 798

Anti-Alpha Fetoprotein Antibody

STJ501651 100 µg
EUR 476

Anti-Alpha-Fetoprotein antibody

STJ16101490 1 mL
EUR 343

Anti- alpha-fetoprotein antibody

STJ16101493 100 µg
EUR 381

Human Alpha Fetoprotein

7-04282 2µg Ask for price

Human Alpha Fetoprotein

7-04283 5µg Ask for price

Human Alpha Fetoprotein

7-04284 10µg Ask for price

Anti-alpha 1 Fetoprotein (1A24)

YF-MA11842 100 ug
EUR 363
Description: Mouse monoclonal to alpha 1 Fetoprotein

Anti-alpha Fetoprotein AFP antibody

STJ16101192 1 mg
EUR 381

Anti-Alpha Fetoprotein Antibody BIOTIN

STJ501652 100 µg
EUR 586

Anti-Alpha Fetoprotein Antibody FITC

STJ501653 100 µg
EUR 586

Alpha Fetoprotein

PR27197 2 ug
EUR 191

Mouse Anti Human Alpha Fetoprotein Monoclonal Antibody

CABT-49287MH 5 ml
EUR 767

Rabbit Anti Human Alpha Fetoprotein Polyclonal Antibody

CPBT-65854RH 1 ml
EUR 767

Human Alpha Fetoprotein (AFP) ELISA Kit, 96 tests, Quantitative

500 1 kit
EUR 469

AFP Alpha-Fetoprotein Human

PROTP02771 Regular: 50ug
EUR 317
Description: Human alpha-fetoprotein purified from human cord serum, shows a 70kDa band on SDS-PAGE.

Anti-Alpha 1 Fetoprotein/Afp Antibody

A00522 100ug/vial
EUR 294

Goat Anti-Alpha Fetoprotein polyclonal antibody

CABT-BL8687 1.0 mg
EUR 663

anti-AFP/alpha 1 Fetoprotein (17C5)

LF-MA20368 100 ug
EUR 354
Description: Mouse monoclonal to AFP/alpha 1 Fetoprotein

Anti-alpha 1 Fetoprotein/AFP Antibody

PB9090 100ug/vial
EUR 334

Anti-alpha-fetoprotein (aa68-82) antibody

STJ73360 100 µg
EUR 359

Anti-AFP alpha 1 Fetoprotein antibody

STJ96977 200 µl
EUR 197
Description: AFP alpha 1 Fetoprotein is a protein encoded by the AFP gene which is approximately 68,6 kDa. AFP alpha 1 Fetoprotein is secreted into the extra cellular space. It is involved in hippo signalling pathway, embryonic stem cell differentiation pathways and FOXA2 and FOXA3 transcription factor networks. It is a major plasma protein produced by the yolk sac and the liver during fetal life. In adults, alpha-fetoprotein expression is often associated with hepatoma or teratoma and is thought to be the fetal counterpart of serum albumin. AFP alpha 1 Fetoprotein is expressed in the heart, liver, cells of the nervous system, lung and blood. Mutations in the AFP gene may result in an alpha-fetoprotein deficiency. STJ96977 was developed from clone 17C5 and was affinity-purified from mouse ascites by affinity-chromatography using specific immunogen. This antibody detects endogenous AFP proteins.

Anti-Alpha-fetoprotein antibody *Mouse anti-human, monoclonal IgG1*

V100065 50 ug
EUR 306
  • R-phrase:
  • H-Phrase:
  • Symbol for dangerous compounds:
  • UNSPEC Code:

Anti-Alpha-fetoprotein antibody *Mouse anti-human, monoclonal IgG1*

V100066 1 mg
EUR 393
  • R-phrase:
  • H-Phrase:
  • Symbol for dangerous compounds:
  • UNSPEC Code:

Alpha-fetoprotein antibody

10R-11470 1 mg
EUR 311
Description: Mouse anti-human Alpha-fetoprotein monoclonal antibody

Alpha-fetoprotein antibody

10-2772 1 mg
EUR 311
Description: Mouse anti-human Alpha-fetoprotein monoclonal antibody

Alpha-fetoprotein antibody

10-2773 1 mg
EUR 311
Description: Mouse anti-human Alpha-fetoprotein monoclonal antibody

Human Alpha fetoprotein (AFP) purified protein control for Western blot

AFP11-C 100 ul
EUR 286

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Mouse Anti Human Alpha Fetoprotein Receptor Monoclonal Antibody

DMABT-48575MH 0.2 mg
EUR 741

Human alpha-Fetoprotein (AFP) Antibody

32221-05111 150 ug
EUR 261

Human Alpha-Fetoprotein (AFP) Antibody

12021-05011 150 ug
EUR 217

Human Alpha-Fetoprotein (aFP) Protein

20-abx065264
  • EUR 481.00
  • EUR 230.00
  • EUR 1330.00
  • EUR 551.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Alpha-Fetoprotein (aFP) Protein

20-abx065268
  • EUR 481.00
  • EUR 230.00
  • EUR 1330.00
  • EUR 551.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human alpha-Fetoprotein (AFP) Protein

abx670202-1mg 1 mg
EUR 1135
  • Shipped within 1 week.

Human Alpha fetoprotein ELISA kit

E01A0753-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha fetoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha fetoprotein ELISA kit

E01A0753-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha fetoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha fetoprotein ELISA kit

E01A0753-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha fetoprotein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Alpha-fetoprotein Protein

RP00243 10 μg
EUR 230

Pig Alpha Fetoprotein (?FP) ELISA Kit, 96 tests, Quantitative

9930 1 Kit
EUR 773

Mouse Anti-Human Alpha-Fetoprotein monoclonal antibody, clone JID621

CABT-L2908-100uL500uL 100 uL, 500 uL
EUR 502

Mouse Alpha-fetoprotein (Afp)

1-CSB-EP001421MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 69.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Alpha-fetoprotein(Afp) expressed in E.coli

Mouse Alpha-fetoprotein (Afp)

1-CSB-EP001421MOe1
  • EUR 621.00
  • EUR 381.00
  • EUR 1943.00
  • EUR 882.00
  • EUR 1335.00
  • EUR 451.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Alpha-fetoprotein(Afp) expressed in E.coli

Mouse Alpha-fetoprotein (Afp)

1-CSB-YP001421MO
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Alpha-fetoprotein(Afp) expressed in Yeast

Alpha-Fetoprotein (AFP) Antibody

abx022523-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx022524-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx025195-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx025195-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx025196-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027957-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027957-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027958-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027958-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx018327-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx019011-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020102-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020507-1mg 1 mg
EUR 662
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020508-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020509-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020510-1mg 1 mg
EUR 648
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020512-1mg 1 mg
EUR 648
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020513-1mg 1 mg
EUR 690
  • Shipped within 5-10 working days.

 

Dose-response Affiliation between C-Reactive Protein and Threat of All-Trigger and Trigger-Particular Mortality: A Systematic Evaluation and Meta-Evaluation of Cohort Research

 

Goal: To quantitatively assess the affiliation between CRP and all-cause, heart problems (CVD), and most cancers mortality, a dose-response meta-analysis was carried out on information from cohort research normally inhabitants.

Strategies: The printed related articles have been looked for in PubMed, Internet of Science, and Embase till September 21, 2019. The pooled relative danger (RR) was estimated by random results of generalized least sq. regression fashions. The dose-response relationship was modeled utilizing restricted cubic splines.

Anti-Alpha Fetoprotein Antibody BIOTIN

Outcomes: Twenty-two articles have been screened for the meta-analysis. In contrast with the low CRP group, the pooled RR within the average CRP group was 1.30 (95% CI, 1.20-1.41) for all-cause mortality, 1.43 (95% CI, 1.22-1.68) for CVD mortality; the pooled RR within the excessive CRP group was 1.75 (95% CI, 1.59-1.92) for all-cause mortality, 2.02 (95% CI, 1.70-2.41) for CVD mortality, and 1.32 (95% CI, 1.21-1.45) for most cancers mortality.

Conclusions: This meta-analysis demonstrated the relationships between CRP and mortality have been nonlinear for all-cause and CVD mortality, and have been linear for most cancers and non-cardiovascular mortality.

 

 

 

Human Alpha Fetoprotein (AFP) ELISA Package, 96 checks, Quantitative

 

  • Alcohol abuse is positively related to heart problems. Dietary low-carbohydrate/high-protein (LCHP) consumption confers a better mortality danger.
  • Right here, the influence of ethanol (Et) consumption together with dietary LCHP consumption on left ventricular (LV) systolic operate and deadly ventricular arrhythmia susceptibility have been investigated in apolipoprotein E/low-density lipoprotein receptor double-knockout (AL) mice.
  • The underlying mechanisms, cardiac sympathovagal steadiness, beta-adrenergic receptor (ADRB) ranges, and hole junction channel protein connexin 43 (Cx43) expression have been examined. Male AL mice fed an LCHP weight loss program with or with out Et have been bred for 16 weeks.
  • Age-matched male AL and wild-type mice acquired normal chow weight loss program and served as controls.
  • The next have been used to evaluate LV systolic operate, deadly ventricular arrhythmia susceptibility, cardiac sympathovagal steadiness, Cx43 expression, and ADRB ranges: echocardiography; electrocardiography and a ventricular arrhythmia-evoked check; LV tyrosine hydroxylase (TH) expression proven by a fluorescence immunohistochemical examination and the ratio of low-frequency energy to high-frequency energy (LF/HF) as indicated by the center fee variability (HRV); Cx43 expression in each a fluorescence immunohistochemical examination and polymerase chain response (PCR); and ADRB1 and ADRB2 expressions in fluorescence immunohistochemical examination.
  • The outcomes demonstrated that Et consumption together with dietary LCHP consumption worsened LCHP-induced LV systolic dysfunction in AL mice and enhanced their susceptibility within the ventricular arrhythmia-evoked check.
  • There have been concomitant will increase in LV weight, LF/HF ratio proven by HRV, TH, ADRB1, ADRB2, and Cx43 expressions by LV fluorescence immunohistochemistry, and LV Cx43 messenger ribonucleic acid expression by PCR. In AL mice, alcohol consumption mixed with dietary LCHP consumption could thus promote a shift in cardiac sympathovagal steadiness towards sympathetic predominance, the will increase in beta-adrenergic receptors after which have an effect on the hole junction channel protein Cx43, which in flip may contribute to elevated dangers of LV systolic dysfunction and susceptibility to deadly ventricular arrhythmia.

 

ZNF287 Antibody

CSB-PA555215-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

ZNF287 Antibody

CSB-PA555215-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

ZNF287 Antibody

1-CSB-PA026644LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ZNF287 Antibody

1-CSB-PA040061
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

ZNF287 Antibody

AF0684 200ul
EUR 304
Description: ZNF287 Antibody detects endogenous levels of ZNF287.

ZNF287 Antibody

ABD3440 100 ug
EUR 438

ZNF287 Antibody

ABF0684 100 ug
EUR 438

ZNF287 Conjugated Antibody

C34071 100ul
EUR 397

ZNF287 Polyclonal Antibody

A63848 100 µg
EUR 570.55
Description: kits suitable for this type of research

ZNF287 Polyclonal Antibody

ABP55891-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ZNF287 from Human. This ZNF287 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290

ZNF287 Polyclonal Antibody

ABP55891-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ZNF287 from Human. This ZNF287 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290

ZNF287 Polyclonal Antibody

ABP55891-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ZNF287 from Human. This ZNF287 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ZNF287 at AA range: 210-290

anti- ZNF287 antibody

FNab09681 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: zinc finger protein 287
  • Uniprot ID: Q9HBT7
  • Gene ID: 57336
  • Research Area: Metabolism
Description: Antibody raised against ZNF287

ZNF287 Polyclonal Antibody

ES6890-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ZNF287 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ZNF287 Polyclonal Antibody

ES6890-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZNF287 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-ZNF287 antibody

PAab09681 100 ug
EUR 412

Anti-ZNF287 antibody

STJ96325 200 µl
EUR 197
Description: Rabbit polyclonal to ZNF287.

ZNF287 siRNA

20-abx940672
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZNF287 siRNA

20-abx940673
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZNF287 Antibody, HRP conjugated

1-CSB-PA026644LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ZNF287 Antibody, FITC conjugated

1-CSB-PA026644LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ZNF287 Antibody, Biotin conjugated

1-CSB-PA026644LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZNF287. Recognizes ZNF287 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-ZNF287/Zfp287 Antibody

A17720 100ul
EUR 397
Description: Rabbit Polyclonal ZNF287/Zfp287 Antibody. Validated in IHC, WB and tested in Human, Mouse.

ZNF287 ELISA KIT|Human

EF004450 96 Tests
EUR 689

Human ZNF287 shRNA Plasmid

20-abx961417
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ZNF287 Recombinant Protein (Human)

RP045112 100 ug Ask for price

ZNF287 Blocking Peptide

DF3440-BP 1mg
EUR 195

ZNF287 Blocking Peptide

AF0684-BP 1mg
EUR 195

ZNF287 cloning plasmid

CSB-CL026644HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2265
  • Sequence: ATGAACAGTTCTTCACGTTCTCAAATCCTTCTAAGGTGGAAGTCAGACAAGGCTCAGAGTGGACCCTACAATGTTGAGAAGGAAATCCTTACTTCAAGATTCTTGCGTGACACTGAGACCTGTCGACAGAATTTTAGGAATTTTCCATACCCAGACCTGGCTGGTCCTCGAAAGG
  • Show more
Description: A cloning plasmid for the ZNF287 gene.

ZNF287 Polyclonal Antibody, HRP Conjugated

A63849 100 µg
EUR 570.55
Description: fast delivery possible

ZNF287 Polyclonal Antibody, FITC Conjugated

A63850 100 µg
EUR 570.55
Description: reagents widely cited

ZNF287 Polyclonal Antibody, Biotin Conjugated

A63851 100 µg
EUR 570.55
Description: Ask the seller for details

ZNF287 ORF Vector (Human) (pORF)

ORF015038 1.0 ug DNA
EUR 354

Mouse ZNF287 shRNA Plasmid

20-abx980321
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Zinc Finger Protein 287 (ZNF287) Antibody

abx037179-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Zinc Finger Protein 287 (ZNF287) Antibody

20-abx013803
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Zinc Finger Protein 287 (ZNF287) Antibody

abx030175-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Zinc Finger Protein 287 (ZNF287) Antibody

abx030175-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Zinc Finger Protein 287 (ZNF287) Antibody

abx239681-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Zinc Finger Protein 287 (ZNF287) Antibody

abx330676-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Zinc Finger Protein 287 (ZNF287) Antibody

20-abx324762
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc Finger Protein 287 (ZNF287) Antibody

20-abx306051
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ZNF287 sgRNA CRISPR Lentivector set (Human)

K2697601 3 x 1.0 ug
EUR 339

Zinc Finger Protein 287 (ZNF287) Antibody (HRP)

20-abx306052
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc Finger Protein 287 (ZNF287) Antibody (FITC)

20-abx306053
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc Finger Protein 287 (ZNF287) Antibody (Biotin)

20-abx306054
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ZNF287 sgRNA CRISPR Lentivector (Human) (Target 1)

K2697602 1.0 ug DNA
EUR 154

ZNF287 sgRNA CRISPR Lentivector (Human) (Target 2)

K2697603 1.0 ug DNA
EUR 154

ZNF287 sgRNA CRISPR Lentivector (Human) (Target 3)

K2697604 1.0 ug DNA
EUR 154

ZNF287 Protein Vector (Human) (pPB-C-His)

PV060149 500 ng
EUR 481

ZNF287 Protein Vector (Human) (pPB-N-His)

PV060150 500 ng
EUR 481

ZNF287 Protein Vector (Human) (pPM-C-HA)

PV060151 500 ng
EUR 481

ZNF287 Protein Vector (Human) (pPM-C-His)

PV060152 500 ng
EUR 481

Human Zinc finger protein 287 (ZNF287) ELISA Kit

abx384442-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Zinc finger protein 287, ZNF287 ELISA KIT

ELI-40715h 96 Tests
EUR 824

ZNF287 3'UTR GFP Stable Cell Line

TU079090 1.0 ml
EUR 1521

ZNF287 3'UTR Luciferase Stable Cell Line

TU029090 1.0 ml
EUR 1521

ZNF287 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2697605 3 x 1.0 ug
EUR 376

Mouse Zinc finger protein 287, Znf287 ELISA KIT

ELI-35477m 96 Tests
EUR 865

ZNF287 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2697606 1.0 ug DNA
EUR 167

ZNF287 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2697607 1.0 ug DNA
EUR 167

ZNF287 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2697608 1.0 ug DNA
EUR 167

Human Insulin Antibody

20010-05011 150 ug
EUR 217

Human Obestatin Antibody

20111-05011 150 ug
EUR 217

Human Lysozyme Antibody

20331-05011 150 ug
EUR 217

Human Kallikrein Antibody

20353-05011 150 ug
EUR 217

Human Lysozyme Antibody

30331-05111 150 ug
EUR 261

Human Geminin Antibody

30012-05111 150 ug
EUR 261

Human PPA2 Antibody

30026-05111 150 ug
EUR 261

Human Ghrelin Antibody

30142-05111 150 ug
EUR 261

Human Albumin antibody

20C-CR2116R 1 ml
EUR 260
Description: Rabbit polyclonal Human Albumin antibody

 

Leave A Comment